Skip to content

Attenuators – preliminary results

June 12, 2011

Very roughly, attenuators switch between two different stem-loop systems depending on how a gene is to be expressed.

I have completed a grammar that locates potential attenuators in the form:

L= {axbxa}

where a and b are compliments and x is any nucleotide.
note two stems are possible, a-b and b-a

The grammar first parses a stem and loop of some given size plus a tail.
Results are sent to a file where the first few nts. are checked for repeats in the first and last nts.

Two examples:

Hepatitis C virus 

GAAGACATCTCATCTTCTGCCACTCAAAGAAG

((((:::::::::)))):::::::::::::::  stem/loop + tail. configuration a
{{{{::::::::::::::::::::::::}}}}  repeat GAAG
:::::::::::::((((:::::::::::))))  head + stem/loop. configuration b
 s/r          s'              r'

Hepatitis C virus 

CCGGTGAGTACACCGGAATTGCCAGGACGACCGG

((((::::::::))))::::::::::::::::::  stem/loop + tail. configuration a
{{{{::::::::::::::::::::::::::}}}}  repeat CCGG
::::::::::::((((::::::::::::::))))  head + stem/loop. configuration b
 s/r          s'               r'

James F. Lynn


Advertisement

From → Uncategorized

Leave a Comment

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Connecting to %s

Follow

Get every new post delivered to your Inbox.