Attenuators – preliminary results

Very roughly, attenuators switch between two different stem-loop systems depending on how a gene is to be expressed.

I have completed a grammar that locates potential attenuators in the form:

L= {axbxa}

where a and b are compliments and x is any nucleotide.
note two stems are possible, a-b and b-a

The grammar first parses a stem and loop of some given size plus a tail.
Results are sent to a file where the first few nts. are checked for repeats in the first and last nts.

Two examples:

Hepatitis C virus 

GAAGACATCTCATCTTCTGCCACTCAAAGAAG

((((:::::::::)))):::::::::::::::  stem/loop + tail. configuration a
{{{{::::::::::::::::::::::::}}}}  repeat GAAG
:::::::::::::((((:::::::::::))))  head + stem/loop. configuration b
 s/r          s'              r'

Hepatitis C virus 

CCGGTGAGTACACCGGAATTGCCAGGACGACCGG

((((::::::::))))::::::::::::::::::  stem/loop + tail. configuration a
{{{{::::::::::::::::::::::::::}}}}  repeat CCGG
::::::::::::((((::::::::::::::))))  head + stem/loop. configuration b
 s/r          s'               r'

James F. Lynn

Advertisement