Skip to content

Recent work notes on pseudoknots containing TCRs

October 9, 2010

10/09/2010 Notes
James F. Lynn
These are groups of pknots containing TCRs based on the pknot:

((((::::::::::::[[[:::::::::::::::::::::::::::::::::))))::::::]]]
4 12 3 33 6

TCR area TCR area’

Discussion: I’m missing several pknots due to the intial set constraints
of the base grammar. However, the pknots are visually checked for extended stem
length. One may note randomly generated DNA contains approx. 0.7 pknots/10k.
Of note, the TCR areas in the randon vs genomic RNA differ significantly – the
genomic RNA possessing several ordered pairs TCRs in many cases.
——————————————————————————————————————————–
Random DNA n= 100,000 pknots = 7

AATA GCATAGAGGATA GCC ACCACAAAGGTGAAATGTTCCCAGCCTAAGCT ATATTGGACATGGC
ACCACAAAGGTGAAATGTTCCCAGCCTAAGCT 32
* ** * **
GTTC AAGTGTTAATTT GCC ACTCCAGCCTGGTGAAGCACGAAGTTGAGGTA TGAACGGGCCGGGC
ACTCCAGCCTGGTGAAGCACGAAGTTGAGGTA 32
* * ** *
ATCT ACGGGTGTATCG TCA TACTCAATATCTAAAAACTGCAAAGCGACCTA TAGATTCATAATGA
TACTCAATATCTAAAAACTGCAAAGCGACCTA 32
* ** ***
ACCT TTCGAGTCTTGT GTA ACGAACATCGCCTGATAGTCGCTACCTAAATT CAGGTCCAGCCTAC
ACGAACATCGCCTGATAGTCGCTACCTAAATT 32
* * * * *
TGAT GAGGATTCTCCT TCT CCAATGCTGCGCGCCGACGCATCCGACGCCTC GATCAAGTGAGAGA
CCAATGCTGCGCGCCGACGCATCCGACGCCTC 32
* * * ** *
CATG TTTAGAACAGAC ACC ATACACGCCATTAGCTATGAAACGATTGTAGG AGTCGGGTAACATT
ATACACGCCATTAGCTATGAAACGATTGTAGG 32
** **** *
GTAC TGCTCGTGCAGG TAG TCACAAGGCGCCTGGTGCCCCGGGTGCAGGTG CTCTTCACGGCCTT
TCACAAGGCGCCTGGTGCCCCGGGTGCAGGTG 32
** ** ** *
(((( :::::::::::: [[[ ::::::::::::::::::::::::::::::::: ))))::::::]]]

———————————————————————————————————————————-
>gi|2801466|gb|AF033810.1| Fujinami sarcoma virus, complete genome 4788 bp
TGGCCATGCCTGTAGTGATTAAGACAGAGGGACCCGCCTGGACCCCTCTGGAGCCAAAATTGATC TCRP0001
((((::::{{{{::::[[[::::::::::}}}}:::::::::::::::::::))))::::::]]]

>gi|9629900|ref|NC_001866.1| Avian myelocytomatosis virus, complete genome 3392 bp
TGGCCATGCCTGTAGTGATTAACACAGAGGGACCCGCCTGGACCCCTCTGGAGCCAAAATTGATC TCRP0002
((((::::{{{{::::[[[::::::::::}}}}:::::::::::::::::::))))::::::]]]

>gi|108737103|ref|NC_008094.1| Y73 sarcoma virus, complete genome 5188 bp ssrna
GCATTACCGGTGGCCCTGACAACAGCACCACCCTCACTTATCGAAAAGTTTCATGCTTGCTGTCA TCRP0003
((((::::{{{{{:::[[[::::::::}}}}}::::::::::::::::::::))))::::::]]]

>gi|2801479|gb|AF033815.1| Mason-Pfizer monkey virus, complete genome 8557 bp RNA linear
CGGTAATGGCTGGGATTTTGACATGTTAACAGGTTCGGGTAATTATTCCAGCACCGATGCACAAA TCRP0004
(((({{{:{:::::::[[[::::::}}}:}::::::::::::::::::::::))))::::::]]]
CAGTGGTGGCTCATATTTGACCTTAACATAGGCCACCTCCCCTGTGAGCTAGACTGGACAGCCAA TCRP0005
((((:{{::{:::{::[[[:::::::}}::}:::}:::::::::::::::::))))::::::]]]

>gi|2801453|gb|AF033807.1| Mouse mammary tumor virus complete proviral genome 8805 bp DNA
GGAAATAAGTGACTCCAGACCCATGCTTCACATTTACTTAAATGGAAGAAGATTCCTCGGTCTCT TCRP0006
((((:{{{:{{{:{::[[[::::::::::::}}}:}}}:}::::::::::::))))::::::]]]
CTTTGGGATTTCTCCCTTCCCTCGCCTAGTGTAGATCAGTCAGATCAGATTAAAAGCAAAAAGAA TCRP0007
((((:{{{{::{::{:[[[:::::}}}}::}::}::::::::::::::::::))))::::::]]]

>gi|297718719|gb|HM104174.1| Enzootic nasal tumour virus of goats strain ENTV-SC, complete genome 7168 bp RNA linear
CCCCTGGTTCCCCAGGGAAGGTACAGTAAATTTGGAAACGTGGAAGAAGGTGGGGGAACAAATTC TCRP0008
((((::{{:::::{::[[[::::}}:::::}:::::::::::::::::::::))))::::::]]]

>gi|2801494|gb|AF033818.1| Bovine leukemia virus complete genome 8419 bp RNA linear
AACACGTCCTTGTTTAACACCACCCAAGGATGGCACCACCCTTCCCAGAGGTTGTTGTTCAATGT TCRP0009
((((:{{:{:{:::::[[[:::::}}:}:}::::::::::::::::::::::))))::::::]]]

>gi|52222126|gb|AY590142.1| Simian T-lymphotropic virus 1 isolate MarB43, complete genome 9107 bp DNA

TCCCGCGCGTCTCTCCGGGAGAGAAGCGCCAAACACAGTTGGGGGCTCGTCCGGGATCTGAACCC TCRP0010
((((::::::::::::[[[:::::::::::::::::::::::::::::::::))))::::::]]]
GGAAAGGTCCTAAAAACAAAAACAATATTAACCTTGCCTATTATCAGCCCATTTCCCAGGGTTTG TCRP0011
((((::::::::::::[[[:::::::::::::::::::::::::::::::::))))::::::]]]

>gi|2316097|gb|AF009606.1|AF009606 Hepatitis C virus
TTCAAAGACTCCATGGCCTCAGCGCATTTTCACTCCACAGTTACTCTCCAGGTGAAATCAATAGG TCRP0012
((((:{{{{{{::{::[[[::::::::::::}}}}}}::}::::::::::::))))::::::]]]

>gi|169260919|gb|EU420138.1| Bat coronavirus 1A strain AFCD62, complete genome
TCTGAGGCTGATTATAGATGCGCTTGTTTTGCACATCTAGCTAAGGCTATGACAGATTATGCATC TCRP0013
(((({{:::{{{{:::[[[::::::::::::::::}}:::}}}}::::::::))))::::::]]]

Advertisements

From → Pseudoknots

Leave a Comment

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s

%d bloggers like this: